| Bioactivity | Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1]. |
| Name | Bepirovirsen |
| CAS | 1403787-62-1 |
| Sequence | DNA, d(P-thio)([2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]rA-G-G-T-G-A-A-G-m5C-G-A-[2′-O-(2-methoxyethyl)]rA-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rU-[2′-O-(2-methoxyethyl)]rG-[2′-O-(2-methoxyethyl)]m5rC) |
| Molar Mass | 7344.00 |
| Appearance | Solid |
| Transport | Room temperature in continental US; may vary elsewhere. |
| Storage | 4°C, sealed storage, away from moisture *In solvent : -80°C, 6 months; -20°C, 1 month (sealed storage, away from moisture) |
| Reference | [1]. Yuen MF, et al. Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734. |