PeptideDB

L-Palmitoylcarnitine TFA

L-Palmitoylcarnitine TFA

CAS No.:

L-Palmitoylcarnitine TFA is a long-chain acylcarnitine and fatty acid metabolite that accumulates in the sarcolemma duri
Data collection:peptidedb@qq.com

This product is for research use only, not for human use. We do not sell to patients.

L-Palmitoylcarnitine TFA is a long-chain acylcarnitine and fatty acid metabolite that accumulates in the sarcolemma during ischemia and disrupts the membrane lipid environment. L-Palmitoylcarnitine TFA inhibits KATP channel activity through interaction with Kir6.2 without affecting single channel conductance.

Physicochemical Properties


Molecular Formula C25H46F3NO6
Molecular Weight 513.63
Related CAS # L-Palmitoylcarnitine chloride;18877-64-0; 28330-02-1; 2364-67-2; 6865-14-1; 1935-18-8
PubChem CID 155882744
Appearance White to off-white solid powder
Hydrogen Bond Donor Count 1
Hydrogen Bond Acceptor Count 9
Rotatable Bond Count 19
Heavy Atom Count 35
Complexity 482
Defined Atom Stereocenter Count 1
SMILES

CCCCCCCCCCCCCCCC(=O)O[C@H](CC(=O)[O-])C[N+](C)(C)C.C(=O)(C(F)(F)F)O

InChi Key WHBWCHUHDXGAHQ-ZMBIFBSDSA-N
InChi Code

InChI=1S/C23H45NO4.C2HF3O2/c1-5-6-7-8-9-10-11-12-13-14-15-16-17-18-23(27)28-21(19-22(25)26)20-24(2,3)4;3-2(4,5)1(6)7/h21H,5-20H2,1-4H3;(H,6,7)/t21-;/m1./s1
Chemical Name

(3R)-3-hexadecanoyloxy-4-(trimethylazaniumyl)butanoate;2,2,2-trifluoroacetic acid
Synonyms

L-Palmitoylcarnitine (TFA); L-Palmitoylcarnitine TFA; HY-113147B; MS-29537; PD156945; CS-0146703; G17640; (3R)-3-hexadecanoyloxy-4-(trimethylazaniumyl)butanoate;2,2,2-trifluoroacetic acid
HS Tariff Code 2934.99.9001
Storage

Powder-20°C 3 years

4°C 2 years

In solvent -80°C 6 months

-20°C 1 month

Note: Please store this product in a sealed and protected environment, avoid exposure to moisture.
Shipping Condition Room temperature (This product is stable at ambient temperature for a few days during ordinary shipping and time spent in Customs)

Biological Activity


Targets Human Endogenous Metabolite
ln Vitro L-Palmitoylcarnitine (IC50 decreased from 62 to 30 µM) simultaneously increases the ATP sensitivity of the channel and suppresses KATP channel activity through its interaction with Kir6.2 (Figure 1).[3]
We observed a significantly higher level of Palmitoylcarnitine/palcar in prostate cancerous tissue compared to benign tissue. High levels of palcar have been associated with increased gene expression and secretion of the pro‐inflammatory cytokine IL‐6 in cancerous PC3 cells, compared to normal PNT1A cells. Furthermore, we found that high levels of Palmitoylcarnitine/palcar induced a rapid Ca2+ influx in PC3 cells, but not in DU145, BPH‐1, or PNT1A cells. This pattern of Ca2+ influx was also observed in response to DHT. Through the use of whole genome arrays we demonstrated that PNT1A cells exposed to palcar or DHT have a similar biological response.
This study suggests that Palmitoylcarnitine/palcar might act as a potential mediator for prostate cancer progression through its effect on (i) pro‐inflammatory pathways, (ii) Ca2+ influx, and (iii) DHT‐like effects. Further studies need to be undertaken to explore whether this class of compounds has different biological functions at physiological and pathological levels [1].
ln Vivo Palmitoyl-l-carnitine (PC) or L-palmitoylcarnitine, an ischemic metabolite, causes cellular Na+ and Ca2+ overload and cardiac dysfunction. This study determined whether ranolazine [(±)-1-piperazineacetamide, N-(2,6-dimethylphenyl)-4-[2-hydroxy-3-(2-methoxyphenoxy)propyl]-] attenuates PC-induced Na+ current and ventricular contractile dysfunction of the isolated heart. PC/L-palmitoylcarnitine (4 μM, 30 min) increased late Na+ current by 1034 ± 349% in guinea pig isolated ventricular myocytes; ranolazine (10 μM) and tetrodotoxin (TTX, 3 μM) significantly attenuated this effect of PC. PC increased left ventricular end-diastolic pressure (LVEDP), coronary perfusion pressure (CPP), wall stiffness, and cardiac lactate and adenosine release from the isolated heart. Ranolazine (10 μM) significantly reduced the PC-induced increase in LVEDP by 72 ± 6% (n = 6, p < 0.001), reduced left ventricular wall stiffness, and attenuated the PC-induced increase of CPP by 53 ± 10% (n = 6–7, p < 0.05). Ranolazine (10 μM) reduced the PC-induced increases of lactate and adenosine release by 70 ± 8 and 81 ± 5%, respectively (n = 6, p ≤ 0.05 for both). TTX (2 μM) significantly (p < 0.05) reduced PC-induced increases of CPP and LVEDP. Pretreatment of isolated myocytes or hearts with the free radical scavenger tiron (4,5-dihydroxy-1,3-benzenedisulfonic acid, disodium salt) (1 mM) significantly reduced the effects of PC to cause increases of late Na+ current and LVEDP, respectively, but unlike ranolazine or TTX, tiron did not reverse increases of late Na+ current and LVEDP caused by PC. In summary, ranolazine and TTX, inhibitors of the late Na+ current, attenuated the PC-induced ventricular contractile dysfunction and increase of coronary resistance in the guinea pig isolated heart [2].
Cell Assay WST‐1 Viability Assay [1]
Cell viability in response to Palmitoylcarnitine/palcar was determined using WST‐1 viability assay. PNT1A and PC3 cells were seeded in 96‐well culture plates in a final volume of 100 μl/well culture medium and cultured in a humidified atmosphere (37°C, 5% CO2). Cells were allowed to adhere to the plate surface for 36 hr before being treated with palcar (0–100 μM) or vehicle control (DMSO) for 24 hr. Each dose of palcar was tested six times. WST‐1 reagent (10 μl) was added to each well and incubated for 30 min in a humidified atmosphere (37°C, 5% CO2). Quantification of the formazan dye produced by metabolically active cells was performed by a scanning multiwell spectrophotometer, measuring absorbance at 450 nm by microplate ELISA reader.
Measuring IL‐6 Secretion in Response to Palmitoylcarnitine/Palcar [1]
PNT1A, PC3, and LnCaP cells were grown to 70–80% confluence before being treated with palcar (0–100 μM) or vehicle control (DMSO) for 24 hr in a humidified atmosphere (37°C, 5% CO2). Supernatants were then collected and appropriately stored at −20°C until analysis. IL‐6 levels were quantified by using a commercially available ELISA kit following manufacturer's instructions.
Measuring IL‐6 Gene Expression [1]
PNT1A and PC3 cells were grown to 70–80% confluence before treatment with Palmitoylcarnitine/palcar (0–100 μM) or vehicle control (DMSO). The treatment was carried out for 24 hr in a humidified atmosphere (37°C, 5% CO2). Total RNA was extracted using RNeasy mini kit following the manufacturer's procedure. The quantity and quality of RNA was determined using RNA Nanodrop 1000. The ratio of 260/280 was 1.9–2.1 for all samples. IL‐6 gene expression was measured by real time RT‐PCR performed using an Applied Biosystems OneStep Plus real time RT‐PCR system on an optical 96‐well plate in a total volume of 20 μl/well, consisting of TaqMan 1‐step RT‐PCR master mix reagent kit, 20 ng total RNA, and IL‐6 primers and probes: IL‐6 forward sequence [5′‐CTCTTCAGAACGAATTGACAAACAAAT‐3, 100 μM, reverse sequence 5′‐ATGTTACTCTTGTTACATGTCTTCTTTCTC‐3, 100 μM and probe 5′‐TACATCCTCGACGGCATCTCAGCCC‐3′, 100 μM]. Reverse transcription was performed for 30 min at 48°C, amplification Taq activation for 10 min at 95°C, followed by 40 PCR cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min. Reactions were carried out in triplicate and were normalized against an endogenous housekeeping gene, 18 S ribosomal RNA. The amount of mRNA and thus gene expression was quantified based on a standard curve method.
Measuring Ca2+ Influx [1]
Human prostate cells (PNT1A, BPH‐1, DU145, PC3) were cultured to 70–80% confluence, and then they were harvested by using trypsin. Cell suspension in 10% FBS‐supplemented media was centrifuged at 1,500 rpm for 3 min at room temperature. Cell pellet was re‐suspended in 10% FBS‐supplemented media and then incubated for 1 hr at 37°C and 5% CO2. Cells were counted and FURA‐2AM at the final concentration of 250 nM was added to the cell suspension (1 × 106 cells/ml) for 30 min at 37°C and 5% CO2. After washing, cells (100 μl) were seeded in a black 96‐well plate with clear bottom and were immediately treated with vehicle control, histamine (0–20 μM), Palmitoylcarnitine/palcar (0–50 μM) or DHT (0–1 μM). The kinetic of fluorescence was measured using a fluorescence plate reader at 510 nm (excitation) and at both 340 and 380 nm (emission) every 10 sec intervals for 5 min. Ca2+ influx has been expressed in terms of fluorescence ratio.
Microarray Analysis [1]
PNT1A cells were cultured to 70–80% confluence, and then they were treated with DMSO, Palmitoylcarnitine/palcar (0–5 μM) and DHT (10 nM) for 8 hr at 37°C and 5% CO2. RNA was extracted using RNeasy Mini kit as described in the manufacturer's instruction. RNA was quantified by using the Nanodrop 1000 spectrophotometer. RNA quality was analysed by using Agilent Bioanalyser. Gene expression profiling was performed using Affymetrix GeneChip Human Exon 1.0ST Array at Nottingham Arabidopsis Stock Centre following the Affymetrix protocols. Data were analysed using R/Bioconductor 32 and the aroma.affymetrix package 33. Data were robust multiple average (RMA) background‐corrected and quantile normalized. To obtain the gene‐level summaries, linear probe level models were applied to the data. For annotation, the current custom CDF file available at the aroma.affymetrix Web site containing the core probe sets (18708 transcript clusters; 284258 probe sets) was used. Subsequent statistical data analysis to identify differentially expressed genes was performed using limma 34. Genes were identified as differentially expressed at different Benjamini and Hochberg adjusted P values. To identify pathways that were the most over‐presented in the lists of differentially expressed genes, functional analyses using the Database for Annotation, Visualization and Integrated Discovery v6.7
Animal Protocol This study determined whether ranolazine [(+/-)-1-piperazineacetamide, N-(2,6-dimethylphenyl)-4-[2-hydroxy-3-(2-methoxyphenoxy)propyl]-] attenuates PC (L-palmitoylcarnitine)-induced Na(+) current and ventricular contractile dysfunction of the isolated heart. PC/L-palmitoylcarnitine (4 microM, 30 min) increased late Na(+) current by 1034 +/- 349% in guinea pig isolated ventricular myocytes; ranolazine (10 microM) and tetrodotoxin (TTX, 3 microM) significantly attenuated this effect of PC. PC/L-palmitoylcarnitine increased left ventricular end-diastolic pressure (LVEDP), coronary perfusion pressure (CPP), wall stiffness, and cardiac lactate and adenosine release from the isolated heart [2].
Toxicity/Toxicokinetics mouse LD50 subcutaneous 1 gm/kg Acta Biologica et Medica Germanica., 26(1237), 1971 [PMID:5153312]
References

[1]. Accumulation of Palmitoylcarnitine and Its Effect on Pro-Inflammatory Pathways and Calcium Influx in Prostate Cancer. Prostate. 2016 Oct;76(14):1326-37.

[2]. The Late Na+ Current (INa) Inhibitor Ranolazine Attenuates Effects of Palmitoyl-L-Carnitine to Increase Late INa and Cause Ventricular Diastolic Dysfunction. J Pharmacol Exp Ther. 2009 Aug;330(2):550-7.

[3]. Alteration of the membrane lipid environment by L-palmitoylcarnitine modulates K(ATP) channels in guinea-pig ventricular myocytes. Pflugers Arch. 2000;441(2-3):200-207.

Additional Infomation In conclusion, these findings revealed a significant difference of palcar levels between non‐cancerous and cancerous prostate tissue, which highlight the potential use of palcar profiling as a biomarker for the metabolic disturbance associated with prostate cancer. High concentrations of palcar were associated with the induction of both IL‐6 and Ca2+ influx in vitro. The latter was also observed in response to DHT. Furthermore, global gene arrays showed that lower levels of palcar were associated with the induction of many changes in gene expression in the non‐cancerous prostate cells in common with DHT. Since DHT is a hormone associated with prostate growth, the DHT‐like effect of palcar may suggest a potential role of palcar in inducing prostate cancer progression.[1]

Solubility Data


Solubility (In Vitro) DMSO :~100 mg/mL (~194.69 mM)
Solubility (In Vivo) Solubility in Formulation 1: ≥ 2.5 mg/mL (4.87 mM) (saturation unknown) in 10% DMSO + 40% PEG300 + 5% Tween80 + 45% Saline (add these co-solvents sequentially from left to right, and one by one), clear solution.
For example, if 1 mL of working solution is to be prepared, you can add 100 μL of 25.0 mg/mL clear DMSO stock solution to 400 μL PEG300 and mix evenly; then add 50 μL Tween-80 to the above solution and mix evenly; then add 450 μL normal saline to adjust the volume to 1 mL.
Preparation of saline: Dissolve 0.9 g of sodium chloride in 100 mL ddH₂ O to obtain a clear solution.

Solubility in Formulation 2: ≥ 2.5 mg/mL (4.87 mM) (saturation unknown) in 10% DMSO + 90% (20% SBE-β-CD in Saline) (add these co-solvents sequentially from left to right, and one by one), clear solution.
For example, if 1 mL of working solution is to be prepared, you can add 100 μL of 25.0 mg/mL clear DMSO stock solution to 900 μL of 20% SBE-β-CD physiological saline solution and mix evenly.
Preparation of 20% SBE-β-CD in Saline (4°C,1 week): Dissolve 2 g SBE-β-CD in 10 mL saline to obtain a clear solution.

Solubility in Formulation 3: ≥ 2.5 mg/mL (4.87 mM) (saturation unknown) in 10% DMSO + 90% Corn Oil (add these co-solvents sequentially from left to right, and one by one), clear solution.
For example, if 1 mL of working solution is to be prepared, you can add 100 μL of 25.0 mg/mL clear DMSO stock solution to 900 μL of corn oil and mix evenly.

 (Please use freshly prepared in vivo formulations for optimal results.)
Preparing Stock Solutions 1 mg 5 mg 10 mg
1 mM 1.9469 mL 9.7346 mL 19.4693 mL
5 mM 0.3894 mL 1.9469 mL 3.8939 mL
10 mM 0.1947 mL 0.9735 mL 1.9469 mL
*Note: Please select an appropriate solvent for the preparation of stock solution based on your experiment needs. For most products, DMSO can be used for preparing stock solutions (e.g. 5 mM, 10 mM, or 20 mM concentration); some products with high aqueous solubility may be dissolved in water directly. Solubility information is available at the above Solubility Data section. Once the stock solution is prepared, aliquot it to routine usage volumes and store at -20°C or -80°C. Avoid repeated freeze and thaw cycles.