Bioactivity | rno-miR-543-3p antagomirs are chemically-modified oligonucleotides that hybridize with mature miRNAs. The miRNA antagomirs have 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 1 cholesterol group at the 3' end, and full-length nucleotide 2'-methoxy modification. The miRNA antagomirs strongly compete with mature miRNAs to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Stability of miRNA antagomirs appears to be significantly higher than miRNA inhibitors, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo. |
miRBase Accession Number | MI0003525 |
Mature miRNA Sequence |
AAACAUUCGCGGUGCACUUCU |
Stem-loop ID | rno-mir-543 |
Stem-loop Sequence |
GGUGCUUAAUGAGAAGUUGCCCGCGUGUUUUUCGCUUUAUAUGUGACGAAACAUUCGCGGUGCACUUCUUUUUCAGCAUC |
Species | Rat, Goat, Gorilla gorilla |
Molar Mass | 7109.65 |
Transport | Room temperature in continental US; may vary elsewhere. |
Storage | Please store the product under the recommended conditions in the Certificate of Analysis. |