| Bioactivity | rno-miR-346 agomirs are chemically-modified double-strand miRNA mimics with modified mature miRNA strand: 2 phosphorothioates at the 5' end, 4 phosphorothioates at the 3' end, 3' end cholesterol group, and full-length nucleotide 2'-methoxy modification. They are designed to mimic endogenous miRNAs and recommended for miRNA functional studies. Compared with miRNA mimics, they exhibits enhanced cellular uptake, stability and regulatory activity in vivo. |
| miRBase Accession Number | MI0000633 |
| Mature miRNA Sequence |
UGUCUGCCUGAGUGCCUGCCUCU |
| Stem-loop ID | rno-mir-346 |
| Stem-loop Sequence |
UCUGUGUUGGGCAUCUGUCUGCCUGAGUGCCUGCCUCUCUGUUGCUCUGAAGGAGGCAGGGGCUGGGCCUGCAGCUGCCUGGGCAGAGCUGCUCCUUC |
| Species | Rat |
| Molar Mass | 15812.84 |
| Transport | Room temperature in continental US; may vary elsewhere. |
| Storage | Please store the product under the recommended conditions in the Certificate of Analysis. |