| Bioactivity | TauASO-12 (murine) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1]) |
| Name | Tau ASO-12 (murine) |
| Transport | Room temperature in continental US; may vary elsewhere. |
| Storage | Please store the product under the recommended conditions in the Certificate of Analysis. |
| Reference | [1]. DeVos SL, Miller RL, Schoch KM, et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy. Sci Transl Med. 2017;9(374):eaag0481. |