PeptideDB

Tau ASO-12 (murine)

CAS: F: W:

TauASO-12 (murine) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the re
Data collection:peptidedb@qq.com

This product is for research use only, not for human use. We do not sell to patients.

Bioactivity TauASO-12 (murine) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1])
Name Tau ASO-12 (murine)
Transport Room temperature in continental US; may vary elsewhere.
Storage

Please store the product under the recommended conditions in the Certificate of Analysis.

Reference [1]. DeVos SL, Miller RL, Schoch KM, et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy. Sci Transl Med. 2017;9(374):eaag0481.